View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0671_low_30 (Length: 268)
Name: NF0671_low_30
Description: NF0671
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0671_low_30 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 124; Significance: 7e-64; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 124; E-Value: 7e-64
Query Start/End: Original strand, 47 - 182
Target Start/End: Original strand, 23042497 - 23042632
Alignment:
| Q |
47 |
cacagtgccatactgagtggctggcaagctcgtgtatgggtttggttggcatattgttgagtcatctgctggaccaactgaagtggatgtttgaggaatc |
146 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
23042497 |
cacagtgccataccgagtggctggcaagctcgtgtatgggtttggctggcatattgttgagtcatctgctgaaccaactgaagtggatgtttgaggaatc |
23042596 |
T |
|
| Q |
147 |
ttcttcatcccattttgctgctgcttctttatatat |
182 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
23042597 |
ttcttcatcccattttgctgctgcttctttatatat |
23042632 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 112 - 171
Target Start/End: Complemental strand, 22281826 - 22281770
Alignment:
| Q |
112 |
ctgctggaccaactgaagtggatgtttgaggaatcttcttcatcccattttgctgctgct |
171 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| ||| | |||||||||||||||||| |
|
|
| T |
22281826 |
ctgctggaccaactgaagtggatgttcgaggaaccttgt---tcccattttgctgctgct |
22281770 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3169 times since January 2019
Visitors: 4029