View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0671_low_34 (Length: 264)
Name: NF0671_low_34
Description: NF0671
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0671_low_34 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 43 - 240
Target Start/End: Original strand, 6177734 - 6177931
Alignment:
Q |
43 |
ctatgtactttcatgaaggcttgcattctctgcctctgtctcggatgagtacggagttgagtgaaggaaacggttctaatcctttaaatattacatctac |
142 |
Q |
|
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
T |
6177734 |
ctatgtactttcatgaaggcttgcattctctgcctttgtctcggatgagtacggagttgagtgaaggaaacggttctaatcctttaaatatgacatctac |
6177833 |
T |
 |
Q |
143 |
tctgcctcatccccaagacaaccccttgttctatccatcaaatctaccaaacaaaaacacattgccgagtcagccatcaatgtcttcctatccttcat |
240 |
Q |
|
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
6177834 |
tctgcctcatccccaagacaaccccttgctctatccatcaaatctaccaaacaaaaacacattgccgagtcagccatcaatgtcttcctatccttcat |
6177931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University