View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0671_low_35 (Length: 264)
Name: NF0671_low_35
Description: NF0671
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0671_low_35 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 36 - 237
Target Start/End: Complemental strand, 12443908 - 12443707
Alignment:
Q |
36 |
catcatcaatataaccacccaactcttcaactcttttacgttctggtaaataacttggtctatggtcttgagacatgtcaacagctactccacgcttaca |
135 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
12443908 |
catcatcaatataaccacccaactcttcaactcttttacgttctggtaaataacttggtctatggtcttgagacatgtcaacagctactccacgcttaca |
12443809 |
T |
 |
Q |
136 |
aagaactgctcgacaatcaccagcattagcaaccagcaaatgccttccaagtataagggcagtcagtgctgttgtcccacatgaactgctaatactctgc |
235 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
T |
12443808 |
aagaactgctcgacaatcaccagcattagcaaccagcaaatgccttccaagtataagggcagtcagtgctgttgtcccacatgaactgctaatactttgc |
12443709 |
T |
 |
Q |
236 |
tc |
237 |
Q |
|
|
|| |
|
|
T |
12443708 |
tc |
12443707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 89; Significance: 6e-43; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 89; E-Value: 6e-43
Query Start/End: Original strand, 65 - 237
Target Start/End: Original strand, 50810225 - 50810397
Alignment:
Q |
65 |
actcttttacgttctggtaaataacttggtctatggtcttgagacatgtcaacagctactccacgcttacaaagaactgctcgacaatcaccagcattag |
164 |
Q |
|
|
|||||| | |||||||||||||||||||| ||||| |||| |||||| ||||||||| || | | ||||||||||||||||||| ||||||||||||| |
|
|
T |
50810225 |
actcttcttcgttctggtaaataacttggcctatgatctttagacatttcaacagctgtacctctcctacaaagaactgctcgacagtcaccagcattag |
50810324 |
T |
 |
Q |
165 |
caaccagcaaatgccttccaagtataagggcagtcagtgctgttgtcccacatgaactgctaatactctgctc |
237 |
Q |
|
|
|||| |||||||||||||| |||| ||| |||||||||||||| |||||||||||| | |||| ||||||||| |
|
|
T |
50810325 |
caacaagcaaatgccttccgagtacaagtgcagtcagtgctgtcgtcccacatgaattactaacactctgctc |
50810397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University