View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0671_low_41 (Length: 250)
Name: NF0671_low_41
Description: NF0671
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0671_low_41 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 27312302 - 27312082
Alignment:
| Q |
1 |
ttgaaactcattcaaacaaacagcacaagccaatgtgcttttcccgatcttgagtcccttgacattggagtaacgaaaagttgggaatgtgtctataact |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27312302 |
ttgaaactcattcaaacaaacagcacaagccaatgtgcttttcccgatcttgagtcccttgacattggagtaacgaaaagttgggaatgtgtctataact |
27312203 |
T |
|
| Q |
101 |
tcttggttaagaccattacttggctcgttattttgtgaccggagaccatttgctccgttaggtaaagtcaggtcaaaaataactccttgttgatgatcgg |
200 |
Q |
| |
|
|||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27312202 |
tcttggttaagaccgttacttggctcgttgttttgtgaccggagaccatttgctccgttaggtaaagtcaggtcaaaaataactccttgttgatgatcgg |
27312103 |
T |
|
| Q |
201 |
tgcatttagccgagtagagag |
221 |
Q |
| |
|
||||||| ||||||||||||| |
|
|
| T |
27312102 |
tgcattttgccgagtagagag |
27312082 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2692 times since January 2019
Visitors: 4010