View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0671_low_42 (Length: 250)

Name: NF0671_low_42
Description: NF0671
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0671_low_42
NF0671_low_42
[»] chr8 (1 HSPs)
chr8 (12-117)||(3095334-3095439)


Alignment Details
Target: chr8 (Bit Score: 98; Significance: 2e-48; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 12 - 117
Target Start/End: Complemental strand, 3095439 - 3095334
Alignment:
12 aaatagagggagtatatcatttccataccgaaaatattgattaacaaaattaatttttcatgccacgaatctacagtcacttaatctaagttcgattaaa 111  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||    
3095439 aaatagaggaagtatatcatttccataccgaaaatattgattaacaaaattaatttttcatgccacgaatctacagttacttaatctaagttcgattaaa 3095340  T
112 atcatt 117  Q
    ||||||    
3095339 atcatt 3095334  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University