View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0671_low_46 (Length: 225)
Name: NF0671_low_46
Description: NF0671
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0671_low_46 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 28 - 187
Target Start/End: Complemental strand, 14626021 - 14625864
Alignment:
Q |
28 |
ggagcagagatcgtatttgagtagttggaaagacatttattggataaaagttaggtaatacgggcactacaaacagatgtgtattgaagctttatatcct |
127 |
Q |
|
|
||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
T |
14626021 |
ggagcagagatcgtatt-gagtagttggaaagacatttattggataaaa-ttaggtaatacgggcactacaaacagatgtgtattgaagctttatattct |
14625924 |
T |
 |
Q |
128 |
cgtactaccaaacatgtaatatgtaactatgcttctgagtgaaggcttattgggtaccta |
187 |
Q |
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
T |
14625923 |
catactaccaaacatgtaatatgtaactatgcttctgagtgaaggcttattggataccta |
14625864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 48 - 187
Target Start/End: Original strand, 17703546 - 17703685
Alignment:
Q |
48 |
gtagttggaaagacatttattggataaaagttaggtaatacgggcactacaaacagatgtgtattgaagctttatatcctcgtactaccaaacatgtaat |
147 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
T |
17703546 |
gtagttggaaagacatttattggataaaagttaggtaatacgggcactacaaacagatgtgtattgaagctttatatcctcatactaccaaacatgtaat |
17703645 |
T |
 |
Q |
148 |
atgtaactatgcttctgagtgaaggcttattgggtaccta |
187 |
Q |
|
|
|||||||||||||| ||||||||||||||||||||||||| |
|
|
T |
17703646 |
atgtaactatgcttgtgagtgaaggcttattgggtaccta |
17703685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3104 times since January 2019
Visitors: 4028