View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0671_low_48 (Length: 212)
Name: NF0671_low_48
Description: NF0671
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0671_low_48 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 136; Significance: 4e-71; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 1 - 136
Target Start/End: Complemental strand, 55162633 - 55162498
Alignment:
| Q |
1 |
tattggttcatgagactttgaattcgtgaattcacagcagatcttaactgtgtacctgtaaggttaagaacccatgcaggattgtatttagggtcttccc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55162633 |
tattggttcatgagactttgaattcgtgaattcacagcagatcttaactgtgtacctgtaaggttaagaacccatgcaggattgtatttagggtcttccc |
55162534 |
T |
|
| Q |
101 |
agaatatattgtgccctctagctatgattttgttgg |
136 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
55162533 |
agaatatattgtgccctctagctatgattttgttgg |
55162498 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2880 times since January 2019
Visitors: 4017