View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0671_low_50 (Length: 209)
Name: NF0671_low_50
Description: NF0671
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0671_low_50 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 74; Significance: 4e-34; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 1 - 113
Target Start/End: Original strand, 38713608 - 38713719
Alignment:
| Q |
1 |
aagattggagacttgacaaaaactatgcatgatgatttatggtgtttataacatgatatatacttttccttnnnnnnnnnntgatatatagtttttaaag |
100 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
38713608 |
aagattggagacttgacaaaaaatatgcatgatgatttatggtgtttataacatgatatatacttttcctt-aaaaaaaaatgatatatagtttttaaag |
38713706 |
T |
|
| Q |
101 |
ttataactttttg |
113 |
Q |
| |
|
||||||||||||| |
|
|
| T |
38713707 |
ttataactttttg |
38713719 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2759 times since January 2019
Visitors: 4012