View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0671_low_52 (Length: 204)
Name: NF0671_low_52
Description: NF0671
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0671_low_52 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 108; Significance: 2e-54; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 1 - 120
Target Start/End: Original strand, 6634168 - 6634287
Alignment:
| Q |
1 |
cgtccttattttcttcaacacctgcctctttgacactttcactttccttttgttcctcagcagctgaacttgtattgtcaacattattgtttacgtcttt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
6634168 |
cgtccttattttcttcaacacctgcctctttgacactttcaatttccttttgttcctcagcagctgaacttgtattgtcaacattattgtttatgtcttt |
6634267 |
T |
|
| Q |
101 |
ggtttctgtctcatattctt |
120 |
Q |
| |
|
|||||||||||||| ||||| |
|
|
| T |
6634268 |
ggtttctgtctcattttctt |
6634287 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3053 times since January 2019
Visitors: 4024