View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0672_high_8 (Length: 336)
Name: NF0672_high_8
Description: NF0672
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0672_high_8 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 286; Significance: 1e-160; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 286; E-Value: 1e-160
Query Start/End: Original strand, 5 - 311
Target Start/End: Original strand, 5297249 - 5297559
Alignment:
| Q |
5 |
tcttctatcagaaaatacacttggtccagatgatttgacattgatttaatgaatggaccctccaagcttgagtttatcaaccatataatttgacttttgg |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5297249 |
tcttctatcagaaaatacacttggtccagatgatttgacattgatttaatgaatggaccctccaagcttgagtttatcaaccatataatttgacttttgg |
5297348 |
T |
 |
| Q |
105 |
acatatgcttcgatacatacgaaattatcggtagacaaagtgattgttgtaagtcaaatcaactttaaataatattccttttgcttaagttacttc---- |
200 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5297349 |
acatatgcttcgatccatacgaaattatcggtagacaaagtgattgttgtaagtcaaatcaactttaaataatattccttttgcttaagttacttcatta |
5297448 |
T |
 |
| Q |
201 |
attaatgttgtgccccgtctgccgtcatatgaaattctttggattcaatcacatctctaatgaagtggagtttgatatcagtatgtttctctttctcatc |
300 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5297449 |
attaatgttgtgcaccgtctgccgtcatatgaaattctttggattcaatcacatctctaatgaagtggagtttgatatcagtatgtttctctttctcatc |
5297548 |
T |
 |
| Q |
301 |
atatacatgat |
311 |
Q |
| |
|
||||||||||| |
|
|
| T |
5297549 |
atatacatgat |
5297559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University