View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0672_high_9 (Length: 246)
Name: NF0672_high_9
Description: NF0672
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0672_high_9 |
 |  |
|
[»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 23 - 246
Target Start/End: Complemental strand, 7950022 - 7949783
Alignment:
Q |
23 |
aactagcccaacaatcagagactttgtggttttgaaagctttcagaattgaaactcacactcctaatgctccaaaaattgtggaggttctctggcaccct |
122 |
Q |
|
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||| |
|
|
T |
7950022 |
aactagcccagcaatcagagactttgtggttttgaaagctttcagaattgaaactcacattcctaatgctccaaaaattgtggaggatctctggcaccct |
7949923 |
T |
 |
Q |
123 |
cctattcataattggattaaatgcaacactgatggggcttctcaaggcaaccctggc------------------atcttcagaaacaatcagggtgact |
204 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
T |
7949922 |
cctattcataattggattaaatgcaacactgatggggcttctcaaggcaaccctggcttatttgcttgcgctggaatcttcagaaacaatcagggtgact |
7949823 |
T |
 |
Q |
205 |
ccaaaggatgttttgctgcaaacatcggtattgttaactctt |
246 |
Q |
|
|
|||||||||||||||||| ||||||||||||| |||||||| |
|
|
T |
7949822 |
ccaaaggatgttttgctg--aacatcggtattgctaactctt |
7949783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 35; Significance: 0.00000000009; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 132 - 178
Target Start/End: Complemental strand, 26448839 - 26448793
Alignment:
Q |
132 |
aattggattaaatgcaacactgatggggcttctcaaggcaaccctgg |
178 |
Q |
|
|
||||||||||||||||| || ||||| |||||||||||||||||||| |
|
|
T |
26448839 |
aattggattaaatgcaatacagatggtgcttctcaaggcaaccctgg |
26448793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 84 - 157
Target Start/End: Original strand, 24540739 - 24540812
Alignment:
Q |
84 |
cctaatgctccaaaaattgtggaggttctctggcaccctcctattcataattggattaaatgcaacactgatgg |
157 |
Q |
|
|
|||||||||||||||||| | || ||| ||||||||||||| ||| | |||||||| ||||| || |||||||| |
|
|
T |
24540739 |
cctaatgctccaaaaattatagaagttatctggcaccctcccattaaaaattggatcaaatgtaatactgatgg |
24540812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000008; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 104 - 161
Target Start/End: Complemental strand, 34029544 - 34029487
Alignment:
Q |
104 |
ggaggttctctggcaccctcctattcataattggattaaatgcaacactgatggggct |
161 |
Q |
|
|
||||||| ||||||||||||||||| | | ||||||||||||||| |||||||||| |
|
|
T |
34029544 |
ggaggttatctggcaccctcctatttagagatggattaaatgcaactgtgatggggct |
34029487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 86 - 174
Target Start/End: Complemental strand, 49142117 - 49142029
Alignment:
Q |
86 |
taatgctccaaaaattgtggaggttctctggcaccctcctattcataattggattaaatgcaacactgatggggcttctcaaggcaacc |
174 |
Q |
|
|
||||||||||||||| || ||||| || ||||||||| ||||| |||||| | ||||| ||||||||||| | |||||||| |||| |
|
|
T |
49142117 |
taatgctccaaaaatcatgaaggttttcacgcaccctcccattcacaattgggtcaaatgtaacactgatggagtctctcaaggtaacc |
49142029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3598 times since January 2019
Visitors: 4038