View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0672_low_12 (Length: 363)
Name: NF0672_low_12
Description: NF0672
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0672_low_12 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 23 - 326
Target Start/End: Original strand, 24879898 - 24880196
Alignment:
Q |
23 |
atcatcagacgaactcaagtgagttattatttcacacgacatttaatatgannnnnnnnnnnnn----gaatttttgtacatttacttgattgtaaacaa |
118 |
Q |
|
|
|||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||| |
|
|
T |
24879898 |
atcaccagacgaactcaagtgagttattatttcacacgacatttaatatgatttctttttatttttttgaatttttgtacatttacttgattgtagacaa |
24879997 |
T |
 |
Q |
119 |
taaaaagaaacaaaagaaatgtatattatattattacatccgtgcagtagacaaccttgtctcaaacctagatcacttccacttatgctctataaattgc |
218 |
Q |
|
|
|||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
T |
24879998 |
taaaaa---------gaaatgtatattatattattacatccgtgcagtacacaaccttgtctcaaacctagatcacttccacttttgctctataaattgc |
24880088 |
T |
 |
Q |
219 |
aatacactcttccaacattggtctcatcttatgagttaacattgttgctacctatatttttgctttatatcataattatttgaattatattgtaagccac |
318 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
24880089 |
aatacactcttccaacattggtctcatcttatgagttaacattgttgctacctatatatttgctttatatcataattatttgaattatattgtaagccac |
24880188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University