View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0672_low_14 (Length: 341)
Name: NF0672_low_14
Description: NF0672
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0672_low_14 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 294; Significance: 1e-165; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 294; E-Value: 1e-165
Query Start/End: Original strand, 21 - 333
Target Start/End: Original strand, 25695549 - 25695862
Alignment:
| Q |
21 |
acatcatcataataataacctcaatctcaacttt-cacagcatttttcacacacgtggtctccaccatcatgtgaaatgagtgtccttatgtttctaaat |
119 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25695549 |
acatcatcatcataataacctcaatctcaacttttcacagcatttttcacacacgtggtctccaccatcatgtgaaatgagtgtccttatgtttctaaat |
25695648 |
T |
 |
| Q |
120 |
catgactctaccaccacttcttctcaatcttttacaacaacatttagtaacataacaaaatgtgttaccaaactcaaaagacactttcttcattgtttct |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25695649 |
catgactctaccaccacttcttctcaatcttttacaacaacatttagtaacataacaaaatgtgttaccaaactcaaaagacactttcttcattgtttct |
25695748 |
T |
 |
| Q |
220 |
gatttttcttcttctacaatggcacattcttctaaacacactcctcgtacccctacttatctcttaccttgtgtcattgctctctctttcttctctgtca |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
25695749 |
gatttttcttcttctacaatggcacattcttctaaacacactcctcgtacccctacttatctcttaccttgtgtcattgctctctctttcttctctctca |
25695848 |
T |
 |
| Q |
320 |
cagcacttcatctc |
333 |
Q |
| |
|
||||||||| |||| |
|
|
| T |
25695849 |
cagcacttcttctc |
25695862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University