View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0672_low_18 (Length: 320)
Name: NF0672_low_18
Description: NF0672
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0672_low_18 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 15 - 286
Target Start/End: Original strand, 30575941 - 30576212
Alignment:
Q |
15 |
gagcaatcgagtgaaaaatatacctgaaattcatataaatgttgagcaaaaacaactaccaattccaagagcagaaagtccaaccacattgtacattttt |
114 |
Q |
|
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||| |
|
|
T |
30575941 |
gagcaatcgagtgaaaaatatacctgaaattcataaaaatgttgagcaaaaacaactaccaattccaagagcagaaagttcaaccgcattgtacattttt |
30576040 |
T |
 |
Q |
115 |
gatagagtcatatgaaaggaaaaactttcccaaccacgacatacagatctggtccgaatctgtgcttgccgagaatgaatgactttgttgtcgtagtggt |
214 |
Q |
|
|
||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
30576041 |
gatagagccatatgaaaggaaaaactttcccaactgcgacatacagatctggtccgaatctgtgcttgccgagaatgaatgactttgttgtcgtagtggt |
30576140 |
T |
 |
Q |
215 |
tggtttcttccataatatcgacgggagataatacagaggaaggagaacaattatattgaagaaagaaccatt |
286 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
30576141 |
tggtttcttccataatatcgacgggagataatacagaggaaggagaacaattatattgaagaaagaaccatt |
30576212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3632 times since January 2019
Visitors: 4039