View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0672_low_22 (Length: 277)
Name: NF0672_low_22
Description: NF0672
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0672_low_22 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 116; Significance: 5e-59; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 116; E-Value: 5e-59
Query Start/End: Original strand, 69 - 231
Target Start/End: Complemental strand, 33108901 - 33108730
Alignment:
| Q |
69 |
tggatatagagatagaagagcttgagataatttcacgttcat---------taagaattccaaacaactcatcaatagaaagaagagatttagatatcaa |
159 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||| || ||||||||||||||| ||| ||||||||| |
|
|
| T |
33108901 |
tggaaatagagatagaagagcttgagataatttcacgttcatcacgttcattaagaattccaaacaaatcctcaatagaaagaagacattcagatatcaa |
33108802 |
T |
|
| Q |
160 |
tgacaacttgcattacataagtttaaaggacattatgtgcaatacatcaacaagatgttcattgtatgaagg |
231 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33108801 |
tgacaacttacattacataagtttaaaggacattatgtgcaatacatcaacaagatgttcattgtatgaagg |
33108730 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3600 times since January 2019
Visitors: 4038