View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0672_low_26 (Length: 252)
Name: NF0672_low_26
Description: NF0672
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0672_low_26 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 92; Significance: 9e-45; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 92; E-Value: 9e-45
Query Start/End: Original strand, 28 - 123
Target Start/End: Original strand, 7319145 - 7319240
Alignment:
Q |
28 |
attccaagttccatgagacgcataatgattgacatgaaattctatttctcatcgatgaatagatgttgcaagttatatgttaaagaaccatatcca |
123 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
T |
7319145 |
attccaagttccatgagacgcataatgattgacatgaaattctatttctcatcgatgaatagatgctgcaagttatatgttaaagaaccatatcca |
7319240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3191 times since January 2019
Visitors: 4030