View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0672_low_27 (Length: 249)
Name: NF0672_low_27
Description: NF0672
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0672_low_27 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 90; Significance: 1e-43; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 1 - 139
Target Start/End: Complemental strand, 1564042 - 1563897
Alignment:
| Q |
1 |
ggttggtccaatctatttgggctaatccttgaggttaatt-ggcttatct---gttgaattatcacattttcttggcaaatagtttccacgcccctgcag |
96 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||| |||||||||||||| || |
|
|
| T |
1564042 |
ggttggtccaatctatttgggctaatccttgaggttaattaggcttataataggttgaattatcacattttcttggcaaatactttccacgcccctgtag |
1563943 |
T |
|
| Q |
97 |
tattttg---atacacataataaaactttctattttgtgcgatctc |
139 |
Q |
| |
|
||||||| |||||||||| ||||||||||||||||||||||||| |
|
|
| T |
1563942 |
tattttggatatacacataaaaaaactttctattttgtgcgatctc |
1563897 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 104 - 139
Target Start/End: Complemental strand, 1563844 - 1563809
Alignment:
| Q |
104 |
atacacataataaaactttctattttgtgcgatctc |
139 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| |
|
|
| T |
1563844 |
atacacataaaaaaactttctattttgtgcgatctc |
1563809 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3536 times since January 2019
Visitors: 4037