View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0672_low_28 (Length: 246)

Name: NF0672_low_28
Description: NF0672
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0672_low_28
NF0672_low_28
[»] chr2 (1 HSPs)
chr2 (23-246)||(7949783-7950022)
[»] chr8 (2 HSPs)
chr8 (132-178)||(26448793-26448839)
chr8 (84-157)||(24540739-24540812)
[»] chr1 (2 HSPs)
chr1 (104-161)||(34029487-34029544)
chr1 (86-174)||(49142029-49142117)


Alignment Details
Target: chr2 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 23 - 246
Target Start/End: Complemental strand, 7950022 - 7949783
Alignment:
23 aactagcccaacaatcagagactttgtggttttgaaagctttcagaattgaaactcacactcctaatgctccaaaaattgtggaggttctctggcaccct 122  Q
    |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||    
7950022 aactagcccagcaatcagagactttgtggttttgaaagctttcagaattgaaactcacattcctaatgctccaaaaattgtggaggatctctggcaccct 7949923  T
123 cctattcataattggattaaatgcaacactgatggggcttctcaaggcaaccctggc------------------atcttcagaaacaatcagggtgact 204  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||                  |||||||||||||||||||||||||    
7949922 cctattcataattggattaaatgcaacactgatggggcttctcaaggcaaccctggcttatttgcttgcgctggaatcttcagaaacaatcagggtgact 7949823  T
205 ccaaaggatgttttgctgcaaacatcggtattgttaactctt 246  Q
    ||||||||||||||||||  ||||||||||||| ||||||||    
7949822 ccaaaggatgttttgctg--aacatcggtattgctaactctt 7949783  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 35; Significance: 0.00000000009; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 132 - 178
Target Start/End: Complemental strand, 26448839 - 26448793
Alignment:
132 aattggattaaatgcaacactgatggggcttctcaaggcaaccctgg 178  Q
    ||||||||||||||||| || ||||| ||||||||||||||||||||    
26448839 aattggattaaatgcaatacagatggtgcttctcaaggcaaccctgg 26448793  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 84 - 157
Target Start/End: Original strand, 24540739 - 24540812
Alignment:
84 cctaatgctccaaaaattgtggaggttctctggcaccctcctattcataattggattaaatgcaacactgatgg 157  Q
    |||||||||||||||||| | || ||| ||||||||||||| ||| | |||||||| ||||| || ||||||||    
24540739 cctaatgctccaaaaattatagaagttatctggcaccctcccattaaaaattggatcaaatgtaatactgatgg 24540812  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 30; Significance: 0.00000008; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 104 - 161
Target Start/End: Complemental strand, 34029544 - 34029487
Alignment:
104 ggaggttctctggcaccctcctattcataattggattaaatgcaacactgatggggct 161  Q
    ||||||| ||||||||||||||||| | |  |||||||||||||||  ||||||||||    
34029544 ggaggttatctggcaccctcctatttagagatggattaaatgcaactgtgatggggct 34029487  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 86 - 174
Target Start/End: Complemental strand, 49142117 - 49142029
Alignment:
86 taatgctccaaaaattgtggaggttctctggcaccctcctattcataattggattaaatgcaacactgatggggcttctcaaggcaacc 174  Q
    |||||||||||||||  || ||||| ||  ||||||||| ||||| |||||| | ||||| ||||||||||| |  |||||||| ||||    
49142117 taatgctccaaaaatcatgaaggttttcacgcaccctcccattcacaattgggtcaaatgtaacactgatggagtctctcaaggtaacc 49142029  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University