View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0672_low_30 (Length: 244)
Name: NF0672_low_30
Description: NF0672
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0672_low_30 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 58; Significance: 2e-24; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 7 - 64
Target Start/End: Original strand, 2106616 - 2106673
Alignment:
Q |
7 |
attctaagcgatgacatgatttctttgttaaaaacaactatggaactatccctttctt |
64 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
2106616 |
attctaagcgatgacatgatttctttgttaaaaacaactatggaactatccctttctt |
2106673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 7 - 58
Target Start/End: Original strand, 2098162 - 2098212
Alignment:
Q |
7 |
attctaagcgatgacatgatttctttgttaaaaacaactatggaactatccc |
58 |
Q |
|
|
||||| |||||||||| |||||||||||| |||||||| ||||||||||||| |
|
|
T |
2098162 |
attctgagcgatgacacgatttctttgtt-aaaacaaccatggaactatccc |
2098212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University