View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0672_low_31 (Length: 204)
Name: NF0672_low_31
Description: NF0672
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0672_low_31 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 115; Significance: 1e-58; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 1 - 127
Target Start/End: Original strand, 5297236 - 5297361
Alignment:
| Q |
1 |
agtatttggcattgtcttctatcagaaaatacacttggtccagatgatttgacattgatttaatgaatggaccctccaagcttgagtttatcaaccatat |
100 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5297236 |
agtatttggcatt-tcttctatcagaaaatacacttggtccagatgatttgacattgatttaatgaatggaccctccaagcttgagtttatcaaccatat |
5297334 |
T |
 |
| Q |
101 |
aatttgacttttggacatattcttcga |
127 |
Q |
| |
|
|||||||||||||||||||| |||||| |
|
|
| T |
5297335 |
aatttgacttttggacatatgcttcga |
5297361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University