View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0673-Insertion-10 (Length: 325)
Name: NF0673-Insertion-10
Description: NF0673
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0673-Insertion-10 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 147; Significance: 2e-77; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 147; E-Value: 2e-77
Query Start/End: Original strand, 8 - 183
Target Start/End: Complemental strand, 8133391 - 8133216
Alignment:
Q |
8 |
gagatgcattgaaaatctctcgtcactgtttatatgtccaaatttaataaaatnnnnnnncataggtgcatagatatattacaagtttctgcttagtgaa |
107 |
Q |
|
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
T |
8133391 |
gagatgcattgaaaatctctcgtcactatttatatgtccaaatttaataaaataaaaaaacataggtgcatagatatattacaagtttctgcttagtgaa |
8133292 |
T |
 |
Q |
108 |
taagttgccattctcattgatcataaaaatctctagagtctaacatgtgaattttcttcttcattcatcactgcag |
183 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
T |
8133291 |
taagttgccattctcattgatcataaaaatctctagagtctaacatgtgaattttcttcttcattcttcactgcag |
8133216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 9 - 167
Target Start/End: Complemental strand, 8151333 - 8151172
Alignment:
Q |
9 |
agatgcattgaaaatctctcgtcactgtttatatgtccaaatttaataaaatnnnnnnn-cataggtgcatagatatattacaagtttctgcttagtgaa |
107 |
Q |
|
|
|||||||||||||||||||||||||| ||||||| ||||||||| |||||| ||||| |||| ||||||||||||||||| ||||| | ||| |
|
|
T |
8151333 |
agatgcattgaaaatctctcgtcactatttatatatccaaatttcgtaaaataaaaaatacatagttgcaaagatatattacaagtttttgctttgcgaa |
8151234 |
T |
 |
Q |
108 |
taag--ttgccattctcattgatcataaaaatctctagagtctaacatgtgaattttcttct |
167 |
Q |
|
|
|||| ||| |||||||||||||||| |||||||||| ||||| | |||||||||||||||| |
|
|
T |
8151233 |
taagaattgacattctcattgatcatgaaaatctctaaagtctgagatgtgaattttcttct |
8151172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 292 - 325
Target Start/End: Complemental strand, 8133107 - 8133074
Alignment:
Q |
292 |
tctactcataatttgaatcagaataacgtatact |
325 |
Q |
|
|
|||||||||||||||||||||||||||||||||| |
|
|
T |
8133107 |
tctactcataatttgaatcagaataacgtatact |
8133074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 116 - 178
Target Start/End: Complemental strand, 2806938 - 2806877
Alignment:
Q |
116 |
cattctcattgatcataaaaatctctagagtctaacatgtgaattttcttcttcattcatcac |
178 |
Q |
|
|
||||||||||||| |||||||||||| ||||| ||||||||| ||| ||||| ||||||||| |
|
|
T |
2806938 |
cattctcattgattataaaaatctctgaagtctgacatgtgaaattt-ttcttaattcatcac |
2806877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1160 times since January 2019
Visitors: 4365