View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0673-Insertion-13 (Length: 134)
Name: NF0673-Insertion-13
Description: NF0673
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0673-Insertion-13 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 91; Significance: 2e-44; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 91; E-Value: 2e-44
Query Start/End: Original strand, 8 - 102
Target Start/End: Complemental strand, 15198130 - 15198036
Alignment:
Q |
8 |
actttgtctcctatcatcaatctctatgttcccaagaaccaatctatccttgttgttggttctggtaattcaggcaagtcaatccaaaaatacca |
102 |
Q |
|
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
15198130 |
actttggctcctatcatcaatctctatgttcccaagaaccaatctatccttgttgttggttctggtaattcaggcaagtcaatccaaaaatacca |
15198036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1375 times since January 2019
Visitors: 4368