View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0673-Insertion-14 (Length: 115)
Name: NF0673-Insertion-14
Description: NF0673
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0673-Insertion-14 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 97; Significance: 4e-48; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 97; E-Value: 4e-48
Query Start/End: Original strand, 11 - 115
Target Start/End: Original strand, 11330399 - 11330503
Alignment:
| Q |
11 |
cgcaggtgttaagatcagtgcggtttcgtatcagagttaaggggcagtgcgattcgacaaaactgctgagtatcgttgttttagggttgataatataatg |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
11330399 |
cgcaggtgttaagatcagtgcggtttcgtatcagagttaaggggaagtgcgattcgacaaaactgctgagtattgttgttttagggttgataatataatg |
11330498 |
T |
|
| Q |
111 |
gtttc |
115 |
Q |
| |
|
||||| |
|
|
| T |
11330499 |
gtttc |
11330503 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 97; E-Value: 4e-48
Query Start/End: Original strand, 11 - 115
Target Start/End: Original strand, 11488420 - 11488524
Alignment:
| Q |
11 |
cgcaggtgttaagatcagtgcggtttcgtatcagagttaaggggcagtgcgattcgacaaaactgctgagtatcgttgttttagggttgataatataatg |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
11488420 |
cgcaggtgttaagatcagtgcggtttcgtatcagagttaaggggaagtgcgattcgacaaaactgctgagtattgttgttttagggttgataatataatg |
11488519 |
T |
|
| Q |
111 |
gtttc |
115 |
Q |
| |
|
||||| |
|
|
| T |
11488520 |
gtttc |
11488524 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 14 times since January 2019
Visitors: 4368