View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0673-Insertion-16 (Length: 90)
Name: NF0673-Insertion-16
Description: NF0673
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0673-Insertion-16 |
 | |
|
| [»] chr8 (3 HSPs) |
| |
|
| [»] chr2 (1 HSPs) |
| |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 76; Significance: 9e-36; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 76; E-Value: 9e-36
Query Start/End: Original strand, 7 - 90
Target Start/End: Original strand, 8947013 - 8947096
Alignment:
| Q |
7 |
atttgcaaattgacataacttccctttccattttgaagggattttagtcattccattatcattaaaactttcactttcgggcca |
90 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
8947013 |
attttcaaattgacataacttccctttccattttgaagggattttagtcattccattatcattaaaactttcactctcgggcca |
8947096 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 56; E-Value: 8e-24
Query Start/End: Original strand, 7 - 90
Target Start/End: Complemental strand, 8962080 - 8961997
Alignment:
| Q |
7 |
atttgcaaattgacataacttccctttccattttgaagggattttagtcattccattatcattaaaactttcactttcgggcca |
90 |
Q |
| |
|
|||| ||||||||||||| |||||||||||||||||||| |||||||| | |||||||||||| |||||||||||||| ||||| |
|
|
| T |
8962080 |
attttcaaattgacataatttccctttccattttgaaggaattttagtaaatccattatcattgaaactttcactttctggcca |
8961997 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 40; E-Value: 0.00000000000003
Query Start/End: Original strand, 7 - 90
Target Start/End: Complemental strand, 8973482 - 8973399
Alignment:
| Q |
7 |
atttgcaaattgacataacttccctttccattttgaagggattttagtcattccattatcattaaaactttcactttcgggcca |
90 |
Q |
| |
|
|||| ||||||||||||| | |||||||||||||||||| |||| || ||| ||||||| || |||||||||||||| ||||| |
|
|
| T |
8973482 |
attttcaaattgacataattgccctttccattttgaaggaatttgaggcatgtcattatctttgaaactttcactttctggcca |
8973399 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 43; Significance: 5e-16; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 43; E-Value: 5e-16
Query Start/End: Original strand, 12 - 90
Target Start/End: Original strand, 21688169 - 21688247
Alignment:
| Q |
12 |
caaattgacataacttccctttccattttgaagggattttagtcattccattatcattaaaactttcactttcgggcca |
90 |
Q |
| |
|
||||||||||||| | |||||||||||||| || |||||||||||||||| ||| |||||||||||||||| ||||| |
|
|
| T |
21688169 |
caaattgacataattggcctttccattttgagggtattttagtcattccatcatctctaaaactttcactttctggcca |
21688247 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 34; Significance: 0.0000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 34; E-Value: 0.0000000001
Query Start/End: Original strand, 29 - 90
Target Start/End: Original strand, 34963779 - 34963840
Alignment:
| Q |
29 |
cctttccattttgaagggattttagtcattccattatcattaaaactttcactttcgggcca |
90 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| ||| || || || |||||||| ||||| |
|
|
| T |
34963779 |
cctttccattttgaaggaattttagtcattccatcatctttgaagctctcactttctggcca |
34963840 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1399 times since January 2019
Visitors: 4368