View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0673-Insertion-18 (Length: 88)
Name: NF0673-Insertion-18
Description: NF0673
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0673-Insertion-18 |
 |  |
|
[»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 63; Significance: 5e-28; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 63; E-Value: 5e-28
Query Start/End: Original strand, 22 - 88
Target Start/End: Original strand, 52619880 - 52619946
Alignment:
Q |
22 |
gttgtaggttgtagtctgtagctgtaagaatgagattagatcataggctttaattttattacagaaa |
88 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
T |
52619880 |
gttgtaggttgtagtctgtagctgtaagaatgagattagatcacaggctttaattttattacagaaa |
52619946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University