View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0673-Insertion-20 (Length: 59)
Name: NF0673-Insertion-20
Description: NF0673
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0673-Insertion-20 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 49; Significance: 7e-20; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 49; E-Value: 7e-20
Query Start/End: Original strand, 8 - 56
Target Start/End: Original strand, 4665725 - 4665773
Alignment:
| Q |
8 |
tcaagcctgcattcatcaagatagcctagcctttcaaatgtagtttttg |
56 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4665725 |
tcaagcctgcattcatcaagatagcctagcctttcaaatgtagtttttg |
4665773 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.00000002
Query Start/End: Original strand, 8 - 56
Target Start/End: Original strand, 4669024 - 4669073
Alignment:
| Q |
8 |
tcaagcctgcattcatcaagatagcctagccttt-caaatgtagtttttg |
56 |
Q |
| |
|
|||||||||||||| | ||||||||||||||||| |||||||| |||||| |
|
|
| T |
4669024 |
tcaagcctgcattctttaagatagcctagcctttccaaatgtaatttttg |
4669073 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 114 times since January 2019
Visitors: 4370