View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0673-Insertion-21 (Length: 54)
Name: NF0673-Insertion-21
Description: NF0673
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0673-Insertion-21 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 36; Significance: 0.000000000004; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 36; E-Value: 0.000000000004
Query Start/End: Original strand, 8 - 43
Target Start/End: Original strand, 27864358 - 27864393
Alignment:
| Q |
8 |
aatatagcctaaataattttctcttccaattcatct |
43 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
27864358 |
aatatagcctaaataattttctcttccaattcatct |
27864393 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 648 times since January 2019
Visitors: 4387