View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0673_high_26 (Length: 326)
Name: NF0673_high_26
Description: NF0673
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0673_high_26 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 292; Significance: 1e-164; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 292; E-Value: 1e-164
Query Start/End: Original strand, 23 - 318
Target Start/End: Complemental strand, 46442065 - 46441770
Alignment:
| Q |
23 |
atcatcataaactattaaatttgtgctactacgacatccaatattagcaagtccatctgcacacatgttcgcttcccgataagaatgacttatcgttatt |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46442065 |
atcatcataaactattaaatttgtgctactacgacatccaatattagcaagtccatctgcacacatgttcgcttcccgataagaatgacttatcgttatt |
46441966 |
T |
 |
| Q |
123 |
tcccgctcacgctccattagttgccgaattttctgcactggtctccaaccattggcactaacacaccctttcttaatactcatgaatcatgataactgct |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46441965 |
tcccgctcacgctccattagttgccgaattttctgcactggtctccaaccattggcactaacacaccctttcttaatactcatgaatcatgataactgct |
46441866 |
T |
 |
| Q |
223 |
tgggaatcaatacacaactccagtctccaccgccttgaatcctcgatcaatcaccatctgaagcccaagcaaaactcctcaaagctcgcctatgct |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
46441865 |
tgggaatcaatacacaactccagtctccaccgccttgaatcctcgatcaatcaccatctgaagcccaagcaaaactccccaaagctcgcctatgct |
46441770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University