View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0673_high_43 (Length: 256)
Name: NF0673_high_43
Description: NF0673
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0673_high_43 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 1 - 227
Target Start/End: Original strand, 48287016 - 48287234
Alignment:
| Q |
1 |
tctatgttatatgatgaccctcttcatcgatcacttttttagttaataataatcttcattcatgttattccatttgtttaattagcatttcatcttcaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
48287016 |
tctatgttatatgatgaccctcttcatc----acttgtttagttaataataatcttcattcatgttattccatttgttta----gcatttcatcttcaaa |
48287107 |
T |
 |
| Q |
101 |
ttttattggttttgtttagggaaagacttgttagttgtgtcatgttctccaatgaaaatgcagtaaaacttttattaaactatttttcaaaaggtgacaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||| ||||||||||||||||||| |
|
|
| T |
48287108 |
ttttattggttttgtttagggaaagacttgttagttgtgtcatgttctccaatgaaaatgcggtaaaacttttatcaaaccatttttcaaaaggtgacaa |
48287207 |
T |
 |
| Q |
201 |
tctgcaagatcagactatccaaatttc |
227 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
48287208 |
tctgcaagatcagactatccaaatttc |
48287234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University