View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0673_high_47 (Length: 251)
Name: NF0673_high_47
Description: NF0673
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0673_high_47 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 197; Significance: 1e-107; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 21 - 245
Target Start/End: Original strand, 2115736 - 2115959
Alignment:
| Q |
21 |
acatcatcaactagtgtatgaagcagctgaaagtgaaagaatgcccaccaaggaaatgctatagaatcgggacctttccgttgttcttgtcggtcttttt |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2115736 |
acatcatcaactagtgtatgaagcagctgaaagtgaaagaatgcccac-aaggaaatgctatagaatcgggacctttccgttgttcttgtcggtcttttt |
2115834 |
T |
|
| Q |
121 |
ctaaaacataaactccttgaaccaagctagcagctactgactttcgatgatatgcatgatccctgtataagattgaatcttattttgtatcacaataacc |
220 |
Q |
| |
|
||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||| ||||||||| |
|
|
| T |
2115835 |
ctagaacatagactccttgaaccaagctagcagctactgactttcgatgatatgcatgatccctgtataagattgaatcttagttagtattacaataacc |
2115934 |
T |
|
| Q |
221 |
ctaataaccaaaaactataactcag |
245 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
2115935 |
ctaataaccaaaaactataactcag |
2115959 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 21 - 185
Target Start/End: Original strand, 11873302 - 11873466
Alignment:
| Q |
21 |
acatcatcaactagtgtatgaagcagctgaaagtgaaagaatgcccaccaaggaaatgctatagaatcgggacctttccgttgttcttgtcggtcttttt |
120 |
Q |
| |
|
|||||||||| |||||||||| |||||||||| || ||||||| ||||||||||| ||||| || || |||||||| ||||||||||| || || |||| |
|
|
| T |
11873302 |
acatcatcaattagtgtatgatgcagctgaaaatggaagaatgtccaccaaggaagtgctagagcattgggaccttctcgttgttcttgccgatcctttt |
11873401 |
T |
|
| Q |
121 |
ctaaaacataaactccttgaaccaagctagcagctactgactttcgatgatatgcatgatccctg |
185 |
Q |
| |
|
| | || ||||| ||||| ||||| |||||||| ||||||||||||| | | |||| ||||||| |
|
|
| T |
11873402 |
ccagaatgtaaacaccttggaccaaactagcagcaactgactttcgattacaagcatcatccctg |
11873466 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1675 times since January 2019
Visitors: 4428