View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0673_high_51 (Length: 251)

Name: NF0673_high_51
Description: NF0673
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0673_high_51
NF0673_high_51
[»] chr1 (2 HSPs)
chr1 (1-141)||(6486476-6486616)
chr1 (202-251)||(6486678-6486727)


Alignment Details
Target: chr1 (Bit Score: 133; Significance: 3e-69; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 1 - 141
Target Start/End: Original strand, 6486476 - 6486616
Alignment:
1 ggattctctgtatggtgcagcacattgcagagccgtttgtgaactcaaattcagtttacatcaaatggttctgcagcgaactgcaccatgttcatgcaaa 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||    
6486476 ggattctctgtatggtgcagcacattgcagagccgtttgtgaactcaaattcagtttacatcaaacggttctgcagcgaactgcaccatgtacatgcaaa 6486575  T
101 gaatccaaatagctcgtctagtgagctaagggtcatcgaac 141  Q
    |||||||||||||||||||||||||||||||||||||||||    
6486576 gaatccaaatagctcgtctagtgagctaagggtcatcgaac 6486616  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 202 - 251
Target Start/End: Original strand, 6486678 - 6486727
Alignment:
202 ggagagaccttccagggtcgtagtagcaagggctcatgggggaggcggcg 251  Q
    |||||||||||||||||||||||||| |||||||||||||||||||||||    
6486678 ggagagaccttccagggtcgtagtagtaagggctcatgggggaggcggcg 6486727  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1337 times since January 2019
Visitors: 4413