View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0673_high_52 (Length: 250)
Name: NF0673_high_52
Description: NF0673
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0673_high_52 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 15 - 250
Target Start/End: Complemental strand, 41978952 - 41978719
Alignment:
| Q |
15 |
tattttgagaaagagtaaaagaaaaagtgaataacacttaaaactaaagaccaaatgagttaataacaatgcattacttacaggttcagacataaaagcg |
114 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
41978952 |
tattttgagaaagagtaaaa--aaatgtgaataacacttaaaactaaagaccatatgagttaataacaatgcattacttacaggttcagtcataaaagcg |
41978855 |
T |
|
| Q |
115 |
caatctggatcctctactataggtgaaagtgtgccatcataatcgagaaacattgcaatcttcttatcctttgcatggtcgatgattttctcaaaagcgc |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
41978854 |
caatctggatcctctactataggtgaaagtgtgccatcataatcgagaaacattgcaatcttcttattctttgcatggtcgatgattttctcaaaagcgc |
41978755 |
T |
|
| Q |
215 |
ttagtgctgaaggatattccagctggaaaaaagaaa |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
41978754 |
ctagtgctgaaggatattccagctggaaaaaagaaa |
41978719 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1671 times since January 2019
Visitors: 4426