View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0673_high_63 (Length: 206)
Name: NF0673_high_63
Description: NF0673
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0673_high_63 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 121; Significance: 3e-62; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 121; E-Value: 3e-62
Query Start/End: Original strand, 1 - 125
Target Start/End: Original strand, 51742406 - 51742530
Alignment:
Q |
1 |
gcgaatctccccgacctcatctgcggcgattgcaaaaacggcttcgttgaatcaatccccacaccttctcgctctcgttcaccttcttcctcctccgatg |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
51742406 |
gcgaatctccccgacctcatctgcggcgattgcaaaaacggcttcgttgaatcaatccccacaccttctcgctctcgttcaccttcttcctcctccgatg |
51742505 |
T |
 |
Q |
101 |
atcccaatttcggttcacaggttct |
125 |
Q |
|
|
|||||||||||||||||||| |||| |
|
|
T |
51742506 |
atcccaatttcggttcacagtttct |
51742530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 84; Significance: 4e-40; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 84; E-Value: 4e-40
Query Start/End: Original strand, 2 - 125
Target Start/End: Complemental strand, 1864231 - 1864108
Alignment:
Q |
2 |
cgaatctccccgacctcatctgcggcgattgcaaaaacggcttcgttgaatcaatccccacaccttctcgctctcgttcaccttcttcctcctccgatga |
101 |
Q |
|
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||| || || ||||||||||| |||||||| |
|
|
T |
1864231 |
cgaatctccccgacctcatctgcagcgattgcaaaaacggcttcgttgaatcaatccccacaccttctcactcccgctccccttcttcctcttccgatga |
1864132 |
T |
 |
Q |
102 |
tcccaatttcggttcacaggttct |
125 |
Q |
|
|
| |||||| ||||||||| |||| |
|
|
T |
1864131 |
tttcaattttggttcacagtttct |
1864108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 2 - 56
Target Start/End: Complemental strand, 30438552 - 30438498
Alignment:
Q |
2 |
cgaatctccccgacctcatctgcggcgattgcaaaaacggcttcgttgaatcaat |
56 |
Q |
|
|
|||||||||||||||||||| |||||||| |||||||||||||||| |||||||| |
|
|
T |
30438552 |
cgaatctccccgacctcatcagcggcgatcgcaaaaacggcttcgtcgaatcaat |
30438498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University