View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0673_low_103 (Length: 251)
Name: NF0673_low_103
Description: NF0673
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0673_low_103 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 104; Significance: 6e-52; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 13 - 116
Target Start/End: Complemental strand, 12155287 - 12155184
Alignment:
Q |
13 |
aatatcaatcaatgggcaatatttaaaatactataaacaaactattcatgaaatcaaaataaacttaaggctagaagacatgatattacatattgattat |
112 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
12155287 |
aatatcaatcaatgggcaatatttaaaatactataaacaaactattcatgaaatcaaaataaacttaaggctagaagacatgatattacatattgattat |
12155188 |
T |
 |
Q |
113 |
atgc |
116 |
Q |
|
|
|||| |
|
|
T |
12155187 |
atgc |
12155184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 162 - 251
Target Start/End: Complemental strand, 12155137 - 12155048
Alignment:
Q |
162 |
ggattgtatccctttccatgcttcttccaagttgtttctttttacaataacaccattgacttctttcttcataaccaataactcaacaag |
251 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
12155137 |
ggattgtatccctttccatgcttcttccaagttgtttctttttacaataacaccattgacttctttcttcataaccaataactcaacaag |
12155048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University