View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0673_low_103 (Length: 251)

Name: NF0673_low_103
Description: NF0673
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0673_low_103
NF0673_low_103
[»] chr1 (2 HSPs)
chr1 (13-116)||(12155184-12155287)
chr1 (162-251)||(12155048-12155137)


Alignment Details
Target: chr1 (Bit Score: 104; Significance: 6e-52; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 13 - 116
Target Start/End: Complemental strand, 12155287 - 12155184
Alignment:
13 aatatcaatcaatgggcaatatttaaaatactataaacaaactattcatgaaatcaaaataaacttaaggctagaagacatgatattacatattgattat 112  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
12155287 aatatcaatcaatgggcaatatttaaaatactataaacaaactattcatgaaatcaaaataaacttaaggctagaagacatgatattacatattgattat 12155188  T
113 atgc 116  Q
    ||||    
12155187 atgc 12155184  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 162 - 251
Target Start/End: Complemental strand, 12155137 - 12155048
Alignment:
162 ggattgtatccctttccatgcttcttccaagttgtttctttttacaataacaccattgacttctttcttcataaccaataactcaacaag 251  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
12155137 ggattgtatccctttccatgcttcttccaagttgtttctttttacaataacaccattgacttctttcttcataaccaataactcaacaag 12155048  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1164 times since January 2019
Visitors: 4365