View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0673_low_105 (Length: 251)
Name: NF0673_low_105
Description: NF0673
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0673_low_105 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 133; Significance: 3e-69; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 1 - 141
Target Start/End: Original strand, 6486476 - 6486616
Alignment:
Q |
1 |
ggattctctgtatggtgcagcacattgcagagccgtttgtgaactcaaattcagtttacatcaaatggttctgcagcgaactgcaccatgttcatgcaaa |
100 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||| |
|
|
T |
6486476 |
ggattctctgtatggtgcagcacattgcagagccgtttgtgaactcaaattcagtttacatcaaacggttctgcagcgaactgcaccatgtacatgcaaa |
6486575 |
T |
 |
Q |
101 |
gaatccaaatagctcgtctagtgagctaagggtcatcgaac |
141 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
6486576 |
gaatccaaatagctcgtctagtgagctaagggtcatcgaac |
6486616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 202 - 251
Target Start/End: Original strand, 6486678 - 6486727
Alignment:
Q |
202 |
ggagagaccttccagggtcgtagtagcaagggctcatgggggaggcggcg |
251 |
Q |
|
|
|||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
T |
6486678 |
ggagagaccttccagggtcgtagtagtaagggctcatgggggaggcggcg |
6486727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University