View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0673_low_110 (Length: 249)
Name: NF0673_low_110
Description: NF0673
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0673_low_110 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 19 - 249
Target Start/End: Complemental strand, 43195103 - 43194873
Alignment:
| Q |
19 |
acatcatcactcaccaccttccttgtgacgctgacggtgtatgcatggtctgcaaacaaaaaccatcagaaaccgaaacacttcattgcaaaacctgcac |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43195103 |
acatcatcactcaccaccttccttgtgacgctgacggtgtatgcatggtttgcaaacaaaaaccatcagaaaccgaaacacttcattgcaaaacctgcac |
43195004 |
T |
|
| Q |
119 |
aacaccatggcatgctccttgtctccctgttgttccaacaacaagtgaaatgctcgattggttgtgtcctgattgtgctcaaccaagtgatgttgttgct |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43195003 |
aacaccatggcatgctccttgtctccctgttgttccaacaacaagtgaaatgctcgattggttgtgtcctgattgtgctcaaccaagtgatgttgttgct |
43194904 |
T |
|
| Q |
219 |
gcttctgctgctccgtctgttgcgggggatc |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
43194903 |
gcttctgctgctccgtctgttgcgggggatc |
43194873 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1349 times since January 2019
Visitors: 4413