View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0673_low_116 (Length: 228)
Name: NF0673_low_116
Description: NF0673
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0673_low_116 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 6 - 228
Target Start/End: Original strand, 41978463 - 41978685
Alignment:
| Q |
6 |
aagaaaaatatgggaagtctcgatgatgttaggtctaatggttggttggatgctatgaaggcatcttcgcctccaaggaagaaattggtactcaaaggtt |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
41978463 |
aagaaaaatatgggaagtctcgatgatgttaggtctaatggttggttggatgctatgaaggcatcttcgcctccaaggaagaaatcggtactcaaaggtt |
41978562 |
T |
 |
| Q |
106 |
cgagcgctcaggttgcttcaattgactttgacatggaagattataatttatggatggtatggtttatttctactaattaatttctgcctatagttctatg |
205 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41978563 |
cgagcgctctggttgcttcaattgactttgacatggaagattataatttatggatggtatggtttatttctactaattaatttctgcctatagttctatg |
41978662 |
T |
 |
| Q |
206 |
cttggtttcaattaatttatgtc |
228 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
41978663 |
cttggtttcaattaatttatgtc |
41978685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University