View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0673_low_117 (Length: 228)
Name: NF0673_low_117
Description: NF0673
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0673_low_117 |
 |  |
|
[»] chr8 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 55; Significance: 9e-23; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 170 - 228
Target Start/End: Complemental strand, 12393547 - 12393489
Alignment:
Q |
170 |
ctcaataaaatctctctttttctttcttgtttcttcaaaaccagcttgaaaaggaaaca |
228 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
T |
12393547 |
ctcaataaaatctctctttttctttcttgtttcttcaaaaccaacttgaaaaggaaaca |
12393489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 89 - 138
Target Start/End: Complemental strand, 12393627 - 12393578
Alignment:
Q |
89 |
atgtgcattcacggcttcgtttagattgcctccatattcctgcacagtgc |
138 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
12393627 |
atgtgcattcacggcttcgtttagattgcctccatattcctgcacagtgc |
12393578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University