View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0673_low_117 (Length: 228)

Name: NF0673_low_117
Description: NF0673
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0673_low_117
NF0673_low_117
[»] chr8 (2 HSPs)
chr8 (170-228)||(12393489-12393547)
chr8 (89-138)||(12393578-12393627)


Alignment Details
Target: chr8 (Bit Score: 55; Significance: 9e-23; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 170 - 228
Target Start/End: Complemental strand, 12393547 - 12393489
Alignment:
170 ctcaataaaatctctctttttctttcttgtttcttcaaaaccagcttgaaaaggaaaca 228  Q
    ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||    
12393547 ctcaataaaatctctctttttctttcttgtttcttcaaaaccaacttgaaaaggaaaca 12393489  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 89 - 138
Target Start/End: Complemental strand, 12393627 - 12393578
Alignment:
89 atgtgcattcacggcttcgtttagattgcctccatattcctgcacagtgc 138  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||    
12393627 atgtgcattcacggcttcgtttagattgcctccatattcctgcacagtgc 12393578  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 545 times since January 2019
Visitors: 4385