View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0673_low_120 (Length: 219)

Name: NF0673_low_120
Description: NF0673
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0673_low_120
NF0673_low_120
[»] chr1 (1 HSPs)
chr1 (1-165)||(8431506-8431670)


Alignment Details
Target: chr1 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 1 - 165
Target Start/End: Complemental strand, 8431670 - 8431506
Alignment:
1 ccagaaaaacccttaccaacagcatgagtttttgcaccccactttgtattactattttctgatctaaatttgtgatctcttcctggactgaaaggagcgt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8431670 ccagaaaaacccttaccaacagcatgagtttttgcaccccactttgtattactattttctgatctaaatttgtgatctcttcctggactgaaaggagcgt 8431571  T
101 tttgaaatgttattgtgattgctttcatgaacttgttccttagcttactttgtttatctttctcc 165  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8431570 tttgaaatgttattgtgattgctttcatgaacttgttccttagcttactttgtttatctttctcc 8431506  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University