View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0673_low_123 (Length: 215)
Name: NF0673_low_123
Description: NF0673
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0673_low_123 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 51; Significance: 2e-20; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 1 - 51
Target Start/End: Complemental strand, 48666451 - 48666401
Alignment:
Q |
1 |
gaaaaatgcaaccaagttgaaaaaggcggcggaggaagcagtggcggttgg |
51 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
48666451 |
gaaaaatgcaaccaagttgaaaaaggcggcggaggaagcagtggcggttgg |
48666401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 736 times since January 2019
Visitors: 4390