View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0673_low_125 (Length: 211)

Name: NF0673_low_125
Description: NF0673
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0673_low_125
NF0673_low_125
[»] chr8 (1 HSPs)
chr8 (100-140)||(25839997-25840037)


Alignment Details
Target: chr8 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 100 - 140
Target Start/End: Complemental strand, 25840037 - 25839997
Alignment:
100 taagatgaaccacacgaagaagcaactcagtgtctaatagt 140  Q
    |||| ||||||||||||||||||||||||||||||||||||    
25840037 taaggtgaaccacacgaagaagcaactcagtgtctaatagt 25839997  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University