View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0673_low_129 (Length: 210)
Name: NF0673_low_129
Description: NF0673
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0673_low_129 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 101; Significance: 3e-50; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 2 - 106
Target Start/End: Original strand, 53307583 - 53307687
Alignment:
| Q |
2 |
attactactatgttttccattccaagttatggtgatattgatcgtcatgaatatgcctggaagtttaccaatcatgaagagtataatgtgaaatcgccct |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
53307583 |
attactactatgttttccattccaagttatggtgatattgatcgtcatgaatatgcctggaagtttaccaatcatgaagagtataatgtgaaatcgtcct |
53307682 |
T |
|
| Q |
102 |
accat |
106 |
Q |
| |
|
||||| |
|
|
| T |
53307683 |
accat |
53307687 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1034 times since January 2019
Visitors: 4400