View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0673_low_130 (Length: 206)

Name: NF0673_low_130
Description: NF0673
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0673_low_130
NF0673_low_130
[»] chr1 (1 HSPs)
chr1 (1-125)||(51742406-51742530)
[»] chr5 (1 HSPs)
chr5 (2-125)||(1864108-1864231)
[»] chr2 (1 HSPs)
chr2 (2-56)||(30438498-30438552)


Alignment Details
Target: chr1 (Bit Score: 121; Significance: 3e-62; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 121; E-Value: 3e-62
Query Start/End: Original strand, 1 - 125
Target Start/End: Original strand, 51742406 - 51742530
Alignment:
1 gcgaatctccccgacctcatctgcggcgattgcaaaaacggcttcgttgaatcaatccccacaccttctcgctctcgttcaccttcttcctcctccgatg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
51742406 gcgaatctccccgacctcatctgcggcgattgcaaaaacggcttcgttgaatcaatccccacaccttctcgctctcgttcaccttcttcctcctccgatg 51742505  T
101 atcccaatttcggttcacaggttct 125  Q
    |||||||||||||||||||| ||||    
51742506 atcccaatttcggttcacagtttct 51742530  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 84; Significance: 4e-40; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 84; E-Value: 4e-40
Query Start/End: Original strand, 2 - 125
Target Start/End: Complemental strand, 1864231 - 1864108
Alignment:
2 cgaatctccccgacctcatctgcggcgattgcaaaaacggcttcgttgaatcaatccccacaccttctcgctctcgttcaccttcttcctcctccgatga 101  Q
    ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||| || || ||||||||||| ||||||||    
1864231 cgaatctccccgacctcatctgcagcgattgcaaaaacggcttcgttgaatcaatccccacaccttctcactcccgctccccttcttcctcttccgatga 1864132  T
102 tcccaatttcggttcacaggttct 125  Q
    |  |||||| ||||||||| ||||    
1864131 tttcaattttggttcacagtttct 1864108  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 2 - 56
Target Start/End: Complemental strand, 30438552 - 30438498
Alignment:
2 cgaatctccccgacctcatctgcggcgattgcaaaaacggcttcgttgaatcaat 56  Q
    |||||||||||||||||||| |||||||| |||||||||||||||| ||||||||    
30438552 cgaatctccccgacctcatcagcggcgatcgcaaaaacggcttcgtcgaatcaat 30438498  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University