View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0673_low_131 (Length: 205)
Name: NF0673_low_131
Description: NF0673
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0673_low_131 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 116; Significance: 3e-59; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 116; E-Value: 3e-59
Query Start/End: Original strand, 1 - 116
Target Start/End: Original strand, 38116345 - 38116460
Alignment:
Q |
1 |
tgttagcagcagtttctgtttggttgtggcagctatggtgtggccggtttaggtattggtttggagcaactgctggtgcgttttttggatggttgttgtt |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
38116345 |
tgttagcagcagtttctgtttggttgtggcagctatggtgtggccggtttaggtattggtttggagcaactgctggtgcgttttttggatggttgttgtt |
38116444 |
T |
 |
Q |
101 |
gttggaattgatgatg |
116 |
Q |
|
|
|||||||||||||||| |
|
|
T |
38116445 |
gttggaattgatgatg |
38116460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 72; Significance: 6e-33; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 72; E-Value: 6e-33
Query Start/End: Original strand, 6 - 116
Target Start/End: Original strand, 45113790 - 45113898
Alignment:
Q |
6 |
gcagcagtttctgtttggttgtggcagctatggtgtggccggtttaggtattggtttggagcaactgctggtgcgttttttggatggttgttgttgttgg |
105 |
Q |
|
|
||||| |||||||||||||||||||||||| |||||||||| |||||||||||||||||| ||||||||||||| |||||| | ||| ||||||||||| |
|
|
T |
45113790 |
gcagctgtttctgtttggttgtggcagctagggtgtggccgatttaggtattggtttggaacaactgctggtgcatttttttg--ggtggttgttgttgg |
45113887 |
T |
 |
Q |
106 |
aattgatgatg |
116 |
Q |
|
|
||||||||||| |
|
|
T |
45113888 |
aattgatgatg |
45113898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 12 - 88
Target Start/End: Original strand, 22776232 - 22776309
Alignment:
Q |
12 |
gtttctgtttggttgtggcagcta-tggtgtggccggtttaggtattggtttggagcaactgctggtgcgttttttgg |
88 |
Q |
|
|
|||||||||||||||||||||||| || || ||||||||| || |||||||||| || ||||||||| ||||||||| |
|
|
T |
22776232 |
gtttctgtttggttgtggcagctaggggcgttgccggtttacgttttggtttggaacagctgctggtgtgttttttgg |
22776309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 56 - 116
Target Start/End: Complemental strand, 34351933 - 34351873
Alignment:
Q |
56 |
ttggtttggagcaactgctggtgcgttttttggatggttgttgttgttggaattgatgatg |
116 |
Q |
|
|
||||| |||||||| || ||||| | ||||||| ||||||||| ||||||||||||||||| |
|
|
T |
34351933 |
ttggtgtggagcaaatgttggtgtggtttttgggtggttgttgctgttggaattgatgatg |
34351873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University