View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0673_low_131 (Length: 205)

Name: NF0673_low_131
Description: NF0673
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0673_low_131
NF0673_low_131
[»] chr4 (1 HSPs)
chr4 (1-116)||(38116345-38116460)
[»] chr8 (1 HSPs)
chr8 (6-116)||(45113790-45113898)
[»] chr3 (1 HSPs)
chr3 (12-88)||(22776232-22776309)
[»] chr7 (1 HSPs)
chr7 (56-116)||(34351873-34351933)


Alignment Details
Target: chr4 (Bit Score: 116; Significance: 3e-59; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 116; E-Value: 3e-59
Query Start/End: Original strand, 1 - 116
Target Start/End: Original strand, 38116345 - 38116460
Alignment:
1 tgttagcagcagtttctgtttggttgtggcagctatggtgtggccggtttaggtattggtttggagcaactgctggtgcgttttttggatggttgttgtt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38116345 tgttagcagcagtttctgtttggttgtggcagctatggtgtggccggtttaggtattggtttggagcaactgctggtgcgttttttggatggttgttgtt 38116444  T
101 gttggaattgatgatg 116  Q
    ||||||||||||||||    
38116445 gttggaattgatgatg 38116460  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 72; Significance: 6e-33; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 72; E-Value: 6e-33
Query Start/End: Original strand, 6 - 116
Target Start/End: Original strand, 45113790 - 45113898
Alignment:
6 gcagcagtttctgtttggttgtggcagctatggtgtggccggtttaggtattggtttggagcaactgctggtgcgttttttggatggttgttgttgttgg 105  Q
    ||||| |||||||||||||||||||||||| |||||||||| |||||||||||||||||| ||||||||||||| |||||| |  ||| |||||||||||    
45113790 gcagctgtttctgtttggttgtggcagctagggtgtggccgatttaggtattggtttggaacaactgctggtgcatttttttg--ggtggttgttgttgg 45113887  T
106 aattgatgatg 116  Q
    |||||||||||    
45113888 aattgatgatg 45113898  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 12 - 88
Target Start/End: Original strand, 22776232 - 22776309
Alignment:
12 gtttctgtttggttgtggcagcta-tggtgtggccggtttaggtattggtttggagcaactgctggtgcgttttttgg 88  Q
    ||||||||||||||||||||||||  || || ||||||||| || |||||||||| || ||||||||| |||||||||    
22776232 gtttctgtttggttgtggcagctaggggcgttgccggtttacgttttggtttggaacagctgctggtgtgttttttgg 22776309  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 56 - 116
Target Start/End: Complemental strand, 34351933 - 34351873
Alignment:
56 ttggtttggagcaactgctggtgcgttttttggatggttgttgttgttggaattgatgatg 116  Q
    ||||| |||||||| || ||||| | ||||||| ||||||||| |||||||||||||||||    
34351933 ttggtgtggagcaaatgttggtgtggtttttgggtggttgttgctgttggaattgatgatg 34351873  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University