View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0673_low_19 (Length: 413)
Name: NF0673_low_19
Description: NF0673
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0673_low_19 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 133; Significance: 5e-69; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 133; E-Value: 5e-69
Query Start/End: Original strand, 1 - 141
Target Start/End: Original strand, 6486476 - 6486616
Alignment:
| Q |
1 |
ggattctctgtatggtgcagcacattgcagagccgtttgtgaactcaaattcagtttacatcaaatggttctgcagcgaactgcaccatgttcatgcaaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||| |
|
|
| T |
6486476 |
ggattctctgtatggtgcagcacattgcagagccgtttgtgaactcaaattcagtttacatcaaacggttctgcagcgaactgcaccatgtacatgcaaa |
6486575 |
T |
|
| Q |
101 |
gaatccaaatagctcgtctagtgagctaagggtcatcgaac |
141 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6486576 |
gaatccaaatagctcgtctagtgagctaagggtcatcgaac |
6486616 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 118; E-Value: 4e-60
Query Start/End: Original strand, 202 - 319
Target Start/End: Original strand, 6486678 - 6486795
Alignment:
| Q |
202 |
ggagagaccttccagggtcgtagtagtaagggctcatgggggaggcggcgctgctgctacgcatggcatagtcatcgtcagtataggcttctgttgtgga |
301 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6486678 |
ggagagaccttccagggtcgtagtagtaagggctcatgggggaggcggcgctgctgctacgcatggcatagtcatcgtcagtataggcttctgttgtgga |
6486777 |
T |
|
| Q |
302 |
aaatcggggttcggattg |
319 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
6486778 |
aaatcggggttcggattg |
6486795 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 598 times since January 2019
Visitors: 4387