View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0673_low_23 (Length: 397)

Name: NF0673_low_23
Description: NF0673
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0673_low_23
NF0673_low_23
[»] chr1 (1 HSPs)
chr1 (7-232)||(33935336-33935561)


Alignment Details
Target: chr1 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 7 - 232
Target Start/End: Complemental strand, 33935561 - 33935336
Alignment:
7 tccaacaatatcaacaaacagaacccaacaaacccaaactcgaatccagcagcggatctagaacactaaactaaacagcaactagcaacaacaatttttg 106  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||    
33935561 tccaacaatatcaacaaacagaacccaacaaacccaaactcgaatccagcagcggatctagaacactaaactaaacagcagctagcaacaacaacttttg 33935462  T
107 tcgtctagattccatgaagacgaatgtgtgaatccagatcttagatgaagcaaatccttgaattcagacaagacccaggtcaattgagaatcagagtgag 206  Q
    |||||||||||| ||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||| ||||||||| |||||||||||||    
33935461 tcgtctagattcaatgaagacgaatgtgtgaatccagaccttagatgaagcaaatccgtgaattcagacaagacccgggtcaattgcgaatcagagtgag 33935362  T
207 catctcgtatgattgaaggaggacga 232  Q
    |||||||| |||||||||||||||||    
33935361 catctcgtgtgattgaaggaggacga 33935336  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University