View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0673_low_23 (Length: 397)
Name: NF0673_low_23
Description: NF0673
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0673_low_23 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 7 - 232
Target Start/End: Complemental strand, 33935561 - 33935336
Alignment:
Q |
7 |
tccaacaatatcaacaaacagaacccaacaaacccaaactcgaatccagcagcggatctagaacactaaactaaacagcaactagcaacaacaatttttg |
106 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||| |
|
|
T |
33935561 |
tccaacaatatcaacaaacagaacccaacaaacccaaactcgaatccagcagcggatctagaacactaaactaaacagcagctagcaacaacaacttttg |
33935462 |
T |
 |
Q |
107 |
tcgtctagattccatgaagacgaatgtgtgaatccagatcttagatgaagcaaatccttgaattcagacaagacccaggtcaattgagaatcagagtgag |
206 |
Q |
|
|
|||||||||||| ||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||| ||||||||| ||||||||||||| |
|
|
T |
33935461 |
tcgtctagattcaatgaagacgaatgtgtgaatccagaccttagatgaagcaaatccgtgaattcagacaagacccgggtcaattgcgaatcagagtgag |
33935362 |
T |
 |
Q |
207 |
catctcgtatgattgaaggaggacga |
232 |
Q |
|
|
|||||||| ||||||||||||||||| |
|
|
T |
33935361 |
catctcgtgtgattgaaggaggacga |
33935336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University