View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0673_low_25 (Length: 390)
Name: NF0673_low_25
Description: NF0673
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0673_low_25 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 143; Significance: 5e-75; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 143; E-Value: 5e-75
Query Start/End: Original strand, 153 - 365
Target Start/End: Complemental strand, 53090359 - 53090149
Alignment:
| Q |
153 |
cttgcttgtatttgtgtcttttgctttcttcaccgtctaattgaataaaggaagtgaagggnnnnnnnnnttctgcttttaatttttacttttgtctgtg |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
53090359 |
cttgcttgtatttgtgtcttttgctttcttcaccgtctaattgaataaaggaagtgaag--aaaaaaaaattctgcttttaatttttacttttgtctgtg |
53090262 |
T |
|
| Q |
253 |
cacaatatataagtaaattcatttgtgttttcaatatagcgtgacaagagaaatgctagcaacacacattgttggaaaatgtatgttagaatgtgtgttg |
352 |
Q |
| |
|
||| ||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||| ||| ||| | |||||||||| |||||||| |
|
|
| T |
53090261 |
cactatatataagtaaattcatttgtgctttcaatatagtgtgacaagagaaatgctagcaacacacattattgaaaagtatatgttagaacgtgtgttg |
53090162 |
T |
|
| Q |
353 |
ataacatttctca |
365 |
Q |
| |
|
||||||||||||| |
|
|
| T |
53090161 |
ataacatttctca |
53090149 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 38 times since January 2019
Visitors: 4368