View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0673_low_41 (Length: 337)
Name: NF0673_low_41
Description: NF0673
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0673_low_41 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 37; Significance: 0.000000000008; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 7 - 47
Target Start/End: Original strand, 25839997 - 25840037
Alignment:
Q |
7 |
actattagacactgagttgcttcttcgtgtggttcatctta |
47 |
Q |
|
|
|||||||||||||||||||||||||||||||||||| |||| |
|
|
T |
25839997 |
actattagacactgagttgcttcttcgtgtggttcacctta |
25840037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University