View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0673_low_41 (Length: 337)

Name: NF0673_low_41
Description: NF0673
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0673_low_41
NF0673_low_41
[»] chr8 (1 HSPs)
chr8 (7-47)||(25839997-25840037)


Alignment Details
Target: chr8 (Bit Score: 37; Significance: 0.000000000008; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 7 - 47
Target Start/End: Original strand, 25839997 - 25840037
Alignment:
7 actattagacactgagttgcttcttcgtgtggttcatctta 47  Q
    |||||||||||||||||||||||||||||||||||| ||||    
25839997 actattagacactgagttgcttcttcgtgtggttcacctta 25840037  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 198 times since January 2019
Visitors: 4374