View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0673_low_49 (Length: 322)
Name: NF0673_low_49
Description: NF0673
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0673_low_49 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 266; Significance: 1e-148; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 266; E-Value: 1e-148
Query Start/End: Original strand, 30 - 310
Target Start/End: Original strand, 31850302 - 31850583
Alignment:
Q |
30 |
gatattatcctttaaatccctttttaactacataatcatggggtccaaattattttgaaaaggtaggaattgtgttaaaactattataatagttaatcaa |
129 |
Q |
|
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
31850302 |
gatattatcctttaaatccctttttaaatacataatcatggggtccaaattattttgaaaaggtaggaattgtgttaaaactattataatagttaatcaa |
31850401 |
T |
 |
Q |
130 |
ttaatatccatttttgtcaaatgaatttgtatgtgatttcaagattgctatatcaacttttaatttaaacacaatactaaatcatatgaatctcatatag |
229 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
T |
31850402 |
ttaatatccatttttgtcaaatgaatttgtatgtgatttcaagattgctatatcaacttttaatttgaacacaatactaaatcatatgaatctcatatag |
31850501 |
T |
 |
Q |
230 |
ttttggaagatt-atgtgaatttgaatcaacacaatactgtgtcttagaatgaatgtattagaaagtggttggttaaatatt |
310 |
Q |
|
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
31850502 |
ttttggaagattcatgtgaatttgaatcaacacaatactgtgtcttagaatgaatgtattagaaagtggttggttaaatatt |
31850583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University