View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0673_low_50 (Length: 320)
Name: NF0673_low_50
Description: NF0673
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0673_low_50 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 139; Significance: 1e-72; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 139; E-Value: 1e-72
Query Start/End: Original strand, 20 - 174
Target Start/End: Complemental strand, 45047937 - 45047783
Alignment:
Q |
20 |
gaatccaaaagtgtcatagtggatagaattttgggtggccaatattcatgagaatattgtctactaagattcatacgggcttcattcaattcgtctttga |
119 |
Q |
|
|
|||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
T |
45047937 |
gaatccaaaagtgtcatagtggatagaattttggctggccaatattcattagaatattgcctactaagattcatacgggcttcattcaattcgtctttga |
45047838 |
T |
 |
Q |
120 |
tcaagctcgagaaattgcaaacaactatatataggagaaaaacacatattattgg |
174 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
T |
45047837 |
tcaagctcgagaaattgcaaacaactatatataggagaaaaacaaatattattgg |
45047783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 169 - 207
Target Start/End: Original strand, 25839999 - 25840037
Alignment:
Q |
169 |
tattggacactgagttgcttcttcgtgtggttcatctta |
207 |
Q |
|
|
|||| ||||||||||||||||||||||||||||| |||| |
|
|
T |
25839999 |
tattagacactgagttgcttcttcgtgtggttcacctta |
25840037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University