View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0673_low_50 (Length: 320)

Name: NF0673_low_50
Description: NF0673
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0673_low_50
NF0673_low_50
[»] chr8 (2 HSPs)
chr8 (20-174)||(45047783-45047937)
chr8 (169-207)||(25839999-25840037)


Alignment Details
Target: chr8 (Bit Score: 139; Significance: 1e-72; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 139; E-Value: 1e-72
Query Start/End: Original strand, 20 - 174
Target Start/End: Complemental strand, 45047937 - 45047783
Alignment:
20 gaatccaaaagtgtcatagtggatagaattttgggtggccaatattcatgagaatattgtctactaagattcatacgggcttcattcaattcgtctttga 119  Q
    |||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||    
45047937 gaatccaaaagtgtcatagtggatagaattttggctggccaatattcattagaatattgcctactaagattcatacgggcttcattcaattcgtctttga 45047838  T
120 tcaagctcgagaaattgcaaacaactatatataggagaaaaacacatattattgg 174  Q
    |||||||||||||||||||||||||||||||||||||||||||| ||||||||||    
45047837 tcaagctcgagaaattgcaaacaactatatataggagaaaaacaaatattattgg 45047783  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 169 - 207
Target Start/End: Original strand, 25839999 - 25840037
Alignment:
169 tattggacactgagttgcttcttcgtgtggttcatctta 207  Q
    |||| ||||||||||||||||||||||||||||| ||||    
25839999 tattagacactgagttgcttcttcgtgtggttcacctta 25840037  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University